GLOSSARY OF GENETIC TERMS

RELATED WEB PAGES:

https://www.clanlindsay.com/genetic_dna_glossary.htm [Lindsay]
https://www.duerinck.com/define.html [Duerinck]
https://blairgenealogy.com/dna/dna101.html [Blair] definitions are at end of section
https://jordannctoal.homestead.com/JordanDNAProjectDefns.html [Jordan]
https://www.widomaker.com/~gwk/era/dnagloss.htm [Rice/ by Chandler]

https://helios.bto.ed.ac.uk/bto/glossary/ab.htm

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

A

Acquired Disease

A disease acquired during the lifetime of an individual.

Acquired diseases such as coronary heart disease, diabetes, or mental illness are not present at birth.

Adenine (A)

A nitrogenous base, one member of the base pair AT (adenine-thymine).

Allele

Any variant form of a GENE. Alternative form of a genetic locus; a single allele for each locus is inherited from each parent (e.g., at a locus for eye color the allele might result in blue or brown eyes).

For example, at the locus for eye color, a person might carry the allele for either blue or brown eyes.

Allogeneic

Variation in alleles among members of the same species.

Alternative splicing

Different ways of combining a gene's exons to make variants of the complete protein

Alu

A family of approx. 300 bp repetitive sequences, found dispersed throughout the human genome. Almost any 100 kb human nucleotide sequence will have Alu sequences within it.

Amino acid

Any of a class of 20 molecules that are combined to form proteins in living things. The sequence of amino acids in a protein and hence protein function are determined by the genetic code.

Amplification

An increase in the number of copies of a specific DNA fragment; can be in vivo or in vitro.

Antisense

Nucleic acid that has a sequence exactly opposite to an mRNA molecule made by the body; binds to the mRNA molecule to prevent a protein from being made.

Apoptosis

Programmed cell death, the body's normal method of disposing of damaged, unwanted, or unneeded cells.

Arrayed library

Individual primary recombinant clones (hosted in phage, cosmid, YAC, or other vector) that are placed in two-dimensional arrays in microtiter dishes. Each primary clone can be identified by the identity of the plate and the clone location (row and column) on that plate. Arrayed libraries of clones can be used for many applications, including screening for a specific gene or genomic region of interest.

Assembly

Putting sequenced fragments of DNA into their correct chromosomal positions.

Autoradiography

A technique that uses X-ray film to visualize radioactively labeled molecules or fragments of molecules; used in analyzing length and number of DNA fragments after they are separated by gel electrophoresis.

Autosome

A chromosome not involved in sex determination. The diploid human genome consists of a total of 46 chromosomes: 22 pairs of autosomes, and 1 pair of sex chromosomes (the X and Y chromosomes).

Autosomal Dominant

A dominant gene that is carried on an autosome. A gene on one of the non-sex chromosomes that is always expressed, even if only one copy is present. The chance of passing the gene to offspring is 50% for each pregnancy.
Related term(s) autosomal_recessive

Autosome

Any of the "numbered" chromosomes -- not the X, Y, or mitochondrial chromosomes.

B

Backcross

A cross between an animal that is heterozygous for alleles obtained from two parental strains and a second animal from one of those parental strains. Also used to describe the breeding protocol of an outcross followed by a backcross.

Bacterial artificial chromosome (BAC)

A vector used to clone DNA fragments (100- to 300-kb insert size; average, 150 kb) in Escherichia coli cells. Based on naturally occurring F-factor plasmid found in the bacterium E. coli.

Base Analogue

A chemical compound which is sufficiently similar to one of the nitrogenous bases normally found in DNA, that it can replace it. Base analogues may cause mutations, or be used in a modified PCR reaction (e.g. when sequencing)

Base pair (bp)

Two nitrogenous bases (adenine and thymine or guanine and cytosine) held together by weak bonds. Two strands of DNA are held together in the shape of a double helix by the bonds between base pairs.

Base sequence

The order of nucleotide bases in a DNA molecule; determines structure of proteins encoded by that DNA.

Base sequence analysis

A method, sometimes automated, for determining the base sequence.

Behavioral genetics

The study of genes that may influence behavior.

Bioinformatics

The discipline of obtaining information about genomic or protein sequence data. This may involve similarity searches of databases, comparing your unidentified sequence to the sequences in a database, or making predictions about the sequence based on current knowledge of similar sequences. Databases are frequently made publically available through the Internet, or locally at your institution.

Biotechnology

A set of biological techniques developed through basic research and now applied to research and product development. In particular, biotechnology refers to the use by industry of recombinant DNA, cell fusion, and new bioprocessing techniques.

Birth defect

Any harmful trait, physical or biochemical, present at birth, whether a result of a genetic mutation or some other nongenetic factor.

BLAST

A set of programs, used to perform fast similarity searches. Nucleotide sequences can be compared with nucleotide sequences in a database using BLASTN, for example. Complex statistics are applied to judge the significance of each match. Reported sequences may be homologous to, or related to the query sequence. The BLASTP program is used to search a protein database for a match against a query protein sequence. There are several other flavours of BLAST.

BLAST2

A newer release of BLAST. Allows for insertions or deletions in the sequences being aligned. Gapped alignments may be more biologically significant.

Blood Type

Special proteins on the surface of red blood cells.

C

Capillary array

Gel-filled silica capillaries used to separate fragments for DNA sequencing. The small diameter of the capillaries permit the application of higher electric fields, providing high speed, high throughput separations that are significantly faster than traditional slab gels.

Carcinogen

Something which causes cancer to occur by causing changes in a cell's DNA.

Carrier

An individual who possesses an unexpressed, recessive trait.

Cell

The basic unit of any living organism.

The human body is composed of trillions of cells, each too small to be seen with the naked eye. Loosely speaking, a cell is similar to a small water balloon. Complex chemicals, such as proteins float inside each cell.

cDNA

Complementary DNA. DNA copies of the mRNA expressed in a specified tissue. cDNA sequencing has the advantage of only representing expressed genes. Since only ~3% of the vast quantity of DNA in the human genome are coding sequences, cDNA sequencing is particularly useful in certain situations. See EST.

cDNA library

A collection of DNA sequences that code for genes. The sequences are generated in the laboratory from mRNA sequences

CDS or cds

Coding sequence.

Centimorgan (cM)

A unit of measure of recombination frequency. One centimorgan is equal to a 1% chance that a marker at one genetic locus will be separated from a marker at a second locus due to crossing over in a single generation. In human beings, one centimorgan is equivalent, on average, to one million base pairs.

Centromere

A specialized chromosome region to which spindle fibers attach during cell division.

Chimera (pl. chimaera)

An organism that contains cells or tissues with a different genotype. These can be mutated cells of the host organism or cells from a different organism or species.

Chimeraplasty

An experimental targeted repair process in which a desirable sequence of DNA is combined with RNA to form a chimeraplast. These molecules bind selectively to the target DNA. Once bound, the chimeraplast activates a naturally occurring gene-correcting mechanism. Does not use viral or other conventional gene-delivery vectors.

Chloroplast chromosome

Circular DNA found in the photosynthesizing organelle (chloroplast) of plants instead of the cell nucleus where most genetic material is located.

Chromomere

One of the serially aligned beads or granules of a eukaryotic chromosome, resulting from local coiling of a continuous DNA thread.

Chromosomal deletion

The loss of part of a chromosome's DNA.

Chromosomal inversion

Chromosome segments that have been turned 180 degrees. The gene sequence for the segment is reversed with respect to the rest of the chromosome.

Chromosome

The structures in which DNA is housed.

DNA does not float free in cells. It is gathered into bundles called chromosomes. Each chromosome is a single, very long strand of the DNA double helix, plus "packing material."

The self-replicating genetic structure of cells containing the cellular DNA that bears in its nucleotide sequence the linear array of genes. In prokaryotes, chromosomal DNA is circular, and the entire genome is carried on one chromosome. Eukaryotic genomes consist of a number of chromosomes whose DNA is associated with different kinds of proteins.

Chromosome painting

Attachment of certain fluorescent dyes to targeted parts of the chromosome. Used as a diagnositic for particular diseases, e.g. types of leukemia.

Chromosome region p

A designation for the short arm of a chromosome.

Chromosome region q

A designation for the long arm of a chromosome.

Clone

An identical copy of a piece of DNA, or a cell, or a whole plant, or a whole animal.

Population of identical cells or molecules (e.g. DNA), derived from a single ancestor.

Cloning

Creating a new identical copy of DNA, or a cell, or a plant, or an animal that is genetically identical.

Cloning Vector

A molecule that carries a foreign gene into a host, and allows/facilitates the multiplication of that gene in a host. When sequencing a gene that has been cloned using a cloning vector (rather than by PCR), care should be taken not to include the cloning vector sequence when performing similarity searches. Plasmids, cosmids, phagemids, YACs and PACs are example types of cloning vectors.

Codes For...

Shorthand way of saying that a gene is the blueprint for a protein.

A typical sentence with this phrase might say: "The gene for eye color codes for a protein that reflects blue light." The protein blueprint is written in the language of DNA.

Complement

Part of the immune system's method of attacking and killing cells.

Cells are like little water-balloons. If they are punctured and are unable to repair themselves, they die. The complement system is the name given to a group of proteins that kill cells by puncturing them.

Complementary DNA (cDNA)

DNA that is synthesized in the laboratory from a messenger RNA template.

Complementary sequence

Nucleic acid base sequence that can form a double-stranded structure with another DNA fragment by following base-pairing rules (A pairs with T and C with G). The complementary sequence to GTAC for example, is CATG.

Complex trait

Trait that has a genetic component that does not follow strict Mendelian inheritance. May involve the interaction of two or more genes or gene-environment interactions

Concordance

The presence of a given characteristic in both members of a pair of twins.

Examples of the "characteristic" include: eye color, the number of fingers and toes, or the presence or absence of a disease.

Congenital

Inborn. Any trait present at birth, whether the result of a genetic or nongenetic factor.
When a person is born with a condition, the condition is called congenital.

Consensus Sequence

A derived nucleotide sequence that represents a family of similar sequences. Each base in the consensus sequence corresponds to the base most frequently occuring at that position, in the real sequences.

Conserved squence

A base sequence in a DNA molecule (or an amino acid sequence in a protein) that has remained essentially unchanged throughout evolution.

Constitutive ablation

Gene expression that results in cell death.

Contig

Group of cloned (copied) pieces of DNA representing overlapping regions of a particular chromosome.

A DNA sequence that overlaps with another contig. The full set of overlapping sequences (contigs) can be put together to obtain the sequence for a long region of DNA that cannot be sequenced in one run in a sequencing assay. Important in genetic mapping at the molecular level.

Contig map

A map depicting the relative order of a linked library of overlapping clones representing a complete chromosomal segment.

Cosmid

Artificially constructed cloning vector containing the cos gene of phage lambda. Cosmids can be packaged in lambda phage particles for infection into E. coli; this permits cloning of larger DNA fragments (up to 45kb) than can be introduced into bacterial hosts in plasmid vectors.

Crossing over

The breaking during meiosis of one maternal and one paternal chromosome, the exchange of corresponding sections of DNA, and the rejoining of the chromosomes. This process can result in an exchange of alleles between chromosomes.

Cytological band

An area of the chromosome that stains differently from areas around it.

Cytological map

A type of chromosome map whereby genes are located on the basis of cytological findings obtained with the aid of chromosome mutations.

Cytoplasmic trait

A genetic characteristic in which the genes are found outside the nucleus, in chloroplasts or mitochondria. Results in offspring inheriting genetic material from only one parent.

Cytosine (C)

A nitrogenous base, one member of the base pair GC (guanine and cytosine) in DNA.
See also: base pair, nucleotide

D

Data warehouse

A collection of databases, data tables, and mechanisms to access the data on a single subject.

Deletion

A loss of part of the DNA from a chromosome; can lead to a disease or abnormality.

Deletion map

A description of a specific chromosome that uses defined mutations --specific deleted areas in the genome-- as 'biochemical signposts,' or markers for specific areas.

Deoxyribonucleic Acid

See DNA.

Deoxyribonucleotide

See: nucleotide

Deoxyribose

A type of sugar that is one component of DNA (deoxyribonucleic acid).

Diploid

A full set of genetic material consisting of paired chromosomes, one from each parental set. Most animal cells except the gametes have a diploid set of chromosomes. The diploid human genome has 46 chromosomes.

Dizygotic Twins

Twins that arose from two fertilized eggs.

	Fragment	Meaning	Language
derivation	di	two	Greek
derivation	zygote	fertilized egg	Greek

DNA

The carrier of genetic information for all complex organisms.

The molecule that encodes genetic information. DNA is a double-stranded molecule held together by weak bonds between base pairs of nucleotides. The four nucleotides in DNA contain the bases adenine (A), guanine (G), cytosine (C), and thymine (T). In nature, base pairs form only between A and T and between G and C; thus the base sequence of each single strand can be deduced from that of its partner.

DNA is shaped like a twisted step-ladder -- the famous "double helix." The genetic information is carried on the rungs of the ladder.

DNA bank

A service that stores DNA extracted from blood samples or other human tissue.

DNA Letter

A non-standard term for the nucleotide bases in DNA.

The DNA molecule is built from smaller molecules strung together, like pearls on a necklace. These smaller molecules (there are four of them) are abbreviated A, C, G, and T.

This means DNA can be read like a book that has been written in a four-letter alphabet. For example, one section of DNA might be the equivalent of the following DNA letters:

ACTATATCGGCATCGAAGC

We use the term "DNA letter" because it highlights the fact that DNA records information, and because it is easier to remember and pronounce than is "nucleotide base pair."

DNA probe

See: probe

DNA repair genes

Genes encoding proteins that correct errors in DNA sequencing.

DNA replication

The use of existing DNA as a template for the synthesis of new DNA strands. In humans and other eukaryotes, replication occurs in the cell nucleus.

DNA sequence

The relative order of base pairs, whether in a DNA fragment, gene, chromosome, or an entire genome.

DNA Polymorphism

Common variations in DNA found from person to person.

Example: The gene for dark eyes has common variants that result in blue eyes. Thus, the gene for eye color is polymorphic.

DNA Sequencing

The experimental process of determining the nucleotide sequence of a region of DNA. This is done by labelling each nucleotide (A, C, G or T) with either a radioactive or fluorescent marker which identifies it. There are several methods of applying this technology, each with their advantages and disadvantages. For more information, refer to a current text book. High throughput laboratories frequently use automated sequencers, which are capable of rapidly reading large numbers of templates. Sometimes, the sequences may be generated more quickly than they can be characterised.

Domain

A discrete portion of a protein with its own function. The combination of domains in a single protein determines its overall function.

Dominant

A characteristic of a gene that causes the information it contains to dominate the information that another version of the same gene contains.

Example: Dark-eyed versions of the eye color gene are dominant to the light-eyed versions. In other words, if a person has one copy of the gene variant for dark eyes, and one copy of the gene variant for light eyes, the person will end up with dark eyes because that gene version dominates.

When a dominant gene is carried on one of the autosomes, the gene may be called autosomal dominant.

Related term(s) · recessive

Down's Syndrome

A disorder caused by having three copies of chromosome 21 rather than the normal two.

The disease is characterized by mental retardation and short stature. Extra chromosomes are found more often in children born of older mothers.

Downstream

Toward the 3' end of a nucleotide sequence.

E

Electro-Encephalogram (EEG)

A recording of the brain's electrical activity.

The recording is performed by applying electrodes to the scalp -- similar to the electrodes that are attached to the chest during an electrocardiogram (EKG).

Electrophoresis

A method of separating large molecules (such as DNA fragments or proteins) from a mixture of similar molecules. An electric current is passed through a medium containing the mixture, and each kind of molecule travels through the medium at a different rate, depending on its electrical charge and size. Agarose and acrylamide gels are the media commonly used for electrophoresis of proteins and nucleic acids.

Electroporation

A process using high-voltage current to make cell membranes permeable to allow the introduction of new DNA; commonly used in recombinant DNA technology.

EMBL

European Molecular Biology Laboratories. Maintain the EMBL database, one of the major public sequence databases.

EMBnet

European Molecular Biology Network: https://www.embnet.org/ was established in 1988, and provides services including local molecular databases and software for molecular biologists in Europe. There are several large outposts of EMBnet, including EXPASY.

Embryonic stem (ES) cells

An embryonic cell that can replicate indefinitely, transform into other types of cells, and serve as a continuous source of new cells.

Endonuclease

See: restriction enzyme

Enhancers

Son los elementos estimuladores de la transcripción. Existen, en general, cuatro “factores de transcripción”

Environment

Factors outside the human body.

To a geneticist, the environment is everything that is not genetic! Some aspects of the environment that influence health and disease are listed below:

· Diet -- food, preservatives, coloring, method of preparation (smoked foods, for example), composition of diet (fats, carbohydrates, protein), and amount.

· Air -- clean air, smog, pollution, tobacco, workplace chemical fumes, dust (coal, cotton, etc.), humidity, temperature.

· Water -- everything we drink, cook, or bathe in. Also, fluoride, pesticides, minerals.

· Radiation -- sunlight, tanning lights, radiation (X rays, microwaves, radio waves).

· Infection -- bacteria, viruses, fungi, parasites. Also includes infection-related factors, such as sanitation and proximity to people, animals, or insects.

Enzyme

A protein that acts as a catalyst, speeding the rate at which a biochemical reaction proceeds but not altering the direction or nature of the reaction. Also, a specialized protein that acts as a catalyst, that is, a protein that speeds up chemical reactions within the cell.

Epistasis

One gene interfers with or prevents the expression of another gene located at a different locus.

Escherichia coli

Common bacterium that has been studied intensively by geneticists because of its small genome size, normal lack of pathogenicity, and ease of growth in the laboratory.

EST

See Expressed Sequence Tag

Eugenics

The study of improving a species by artificial selection; usually refers to the selective breeding of humans.

Eukaryote

Cell or organism with membrane-bound, structurally discrete nucleus and other well-developed subcellular compartments. Eukaryotes include all organisms except viruses, bacteria, and bluegreen algae.

Exogenous DNA

DNA originating outside an organism that has been introducted into the organism.

Exonuclease

An enzyme that cleaves nucleotides sequentially from free ends of a linear nucleic acid substrate.

Expressed gene

See: gene expression

Exon

The protein-coding DNA sequence of a gene.
Coding region of DNA.

Expressed Sequence Tag (EST)

Randomly selected, partial cDNA sequence; represents it's corresponding mRNA. dbEST is a large database of ESTs at GenBank, NCBI.

A short strand of DNA that is a part of a cDNA molecule and can act as identifier of a gene. Used in locating and mapping genes.

F

Familial Adenomatous Polyposis (FAP)

An inherited form of colorectal cancer.

Related term(s) · hnpcc

Filial generation (F1, F2)

Each generation of offspring in a breeding program, designated F1, F2, etc.

Fingerprinting

In genetics, the identification of multiple specific alleles on a person's DNA to produce a unique identifier for that person.

Finished DNA Sequence

High-quality, low error, gap-free DNA sequence of the human genome. Achieving this ultimate 2003 HGP goal requires additional sequencing to close gaps, reduce ambiguities, and allow for only a single error every 10,000 bases, the agreed-upon standard for HGP finished sequence.

First Degree Relative

Your first degree relatives are your parents, brothers, sisters, and children.

Second degree relatives include grandparents and grandchildren.

Flow cytometry

Analysis of biological material by detection of the light-absorbing or fluorescing properties of cells or subcellular fractions (i.e., chromosomes) passing in a narrow stream through a laser beam. An absorbance or fluorescence profile of the sample is produced. Automated sorting devices, used to fractionate samples, sort successive droplets of the analyzed stream into different fractions depending on the fluorescence emitted by each droplet.

Flow karyotyping

Use of flow cytometry to analyze and separate chromosomes according to their DNA content.

Fluorescence in situ hybridization (FISH)

A physical mapping approach that uses fluorescein tags to detect hybridization of probes with metaphase chromosomes and with the less-condensed somatic interphase chromatin.

Form Fruste

An incomplete form of an illness.

Example: The Marfan syndrome is a genetic disease with many possible signs and symptoms. These include being tall, being double-jointed, having a leaky heart valve, and having problems with the lens in the eye. Some people with Marfan syndrome do not show all the signs and symptoms. Some people are only tall. These people are said to have a form fruste of the Marfan syndrome, because they do not have enough symptoms and signs to make it easy for doctors to diagnose.

Founder Effect

The presence of a particular gene variant (allele) in a population, inherited from an ancestor.

Example: Suppose you were born with a gene that gives you orange hair and that you and twenty other people are trapped on an island. If the island remains isolated, it may happen that 200 years from now 20% of the people on that island will have orange hair, unlike everyone else in the world.

In this example, you are the founder. Had you stayed in your hometown, in 200 years there may be a few people on earth with orange hair. But they would represent only .0000001% of the population, not 20% as on the island. Founder effects concentrate a particular gene variant in a particular population

Full gene sequence

The complete order of bases in a gene. This order determines which protein a gene will produce.

Functional genomics

The study of genes, their resulting proteins, and the role played by the proteins the body's biochemical processes.

G

Gamete

An egg cell or sperm cell.

These cells carry only 23 chromosomes instead of 46. Only one from each pair of the chromosomes is represented in a gamete. When the two gametes -- egg and sperm -- meet and form a zygote, the full number of 46 chromosomes is restored.

GC-rich area

Many DNA sequences carry long stretches of repeated G and C which often indicate a gene-rich region.

Gel electrophoresis

See: electrophoresis

Gene

A piece of DNA that includes all the code for a specific protein, as well as the code for when the protein is made.

A gene occupies a specific place, or locus, on a chromosome and is always found in the same chromosome in all persons.

Gene amplification

Repeated copying of a piece of DNA; a characteristic of tumor cells.

Gene chip technology

Development of cDNA microarrays from a large number of genes. Used to monitor and measure changes in gene expression for each gene represented on the chip.

Gene Cloning

A method for making identical copies of a particular DNA fragment.

Gene expression

The process by which a gene's coded information is converted into the structures present and operating in the cell. Expressed genes include those that are transcribed into mRNA and then translated into protein and those that are transcribed into RNA but not translated into protein (e.g., transfer and ribosomal RNAs).

Gene family

Group of closely related genes that make similar products.

Gene library

See: genomic library

Gene mapping

Determination of the relative positions of genes on a DNA molecule (chromosome or plasmid) and of the distance, in linkage units or physical units, between them.

Gene Name

The name applied to a gene.

After looking at several gene names, you may start seeing a few patterns.

Some genes incorporate the name for the disease they influence. For example, BRCA1 is related to breast cancer, and HPC1 is related to hereditary prostate cancer. Other genes are named for the protein they produce. For example, the ELN gene produces the protein elastin.

Beyond these simple patterns, it becomes difficult to understand gene names unless you are working in the genetics field.

Gene pool

All the variations of genes in a species.

Gene prediction

Predictions of possible genes made by a computer program based on how well a stretch of DNA sequence matches known gene sequences

Gene product

The biochemical material, either RNA or protein, resulting from expression of a gene. The amount of gene product is used to measure how active a gene is; abnormal amounts can be correlated with disease-causing alleles.

Gene testing

See: genetic testing, genetic screening

Gene therapy

An experimental procedure aimed at replacing, manipulating, or supplementing nonfunctional or misfunctioning genes with healthy genes.

Introducing a gene into the human body for the purposes of correcting a genetic defect or deficiency.

Gene transfer

Incorporation of new DNA into and organism's cells, usually by a vector such as a modified virus. Used in gene therapy.

Genetic code

The sequence of nucleotides, coded in triplets (codons) along the mRNA, that determines the sequence of amino acids in protein synthesis. A gene's DNA sequence can be used to predict the mRNA sequence, and the genetic code can in turn be used to predict the amino acid sequence.

Genetic counseling

Provides patients and their families with education and information about genetic-related conditions and helps them make informed decisions.

Genetic Counselor

Healthcare professionals who provide information and support to families who have members at risk for, or already have, birth defects or genetic disorders.

Genetic discrimination

Prejudice against those who have or are likely to develop an inherited disorder.

Genetic engineering

Altering the genetic material of cells or organisms to enable them to make new substances or perform new functions.

Moving DNA from one species to another, or altering any DNA sequence.

Typically, this involves moving DNA from a human cell to bacteria in order to isolate a gene.

Genetic engineering technology

See: recombinant DNA technology

Genetic illness

Sickness, physical disability, or other disorder resulting from the inheritance of one or more deleterious alleles.

Genetic informatics

See: bioinformatics

Genetic map

See: linkage map

Genetic marker

A gene or other identifiable portion of DNA whose inheritance can be followed.

Genetic material

See: genome

Genetic mosaic

An organism in which different cells contain different genetic sequence. This can be the result of a mutation during development or fusion of embryos at an early developmental stage.

Genetic polymorphism

Difference in DNA sequence among individuals, groups, or populations (e.g., genes for blue eyes versus brown eyes).

Genetic predisposition

Susceptibility to a genetic disease. May or may not result in actual development of the disease.

Genetic screening

Testing a group of people to identify individuals at high risk of having or passing on a specific genetic disorder.

Genetic testing

Analyzing an individual's genetic material to determine predisposition to a particular health condition or to confirm a diagnosis of genetic disease.

Genetics

The study of inheritance patterns of specific traits.

Genome

All the genetic material in the chromosomes of a particular organism; its size is generally given as its total number of base pairs.

Genome project

Research and technology-development effort aimed at mapping and sequencing the genome of human beings and certain model organisms.

Genomic library

A collection of clones made from a set of randomly generated overlapping DNA fragments that represent the entire genome of an organism.

Genomic sequence

See: DNA

Genomics

The study of genes and their function.

Genome

All the DNA of a species.

In other words, the complete set of chromosomes of that species.

Genotype

The genetic constitution of an organism, as distinguished from its physical appearance (its phenotype).

The specific genetic variants of an individual.

In other words, the two alleles at a locus.

Germline Gene Therapy

Inserting DNA into a sperm or egg.

Related term(s) · somatic_gene_therapy · gene_therapy

Germ line

The continuation of a set of genetic information from one generation to the next.

Germ line gene therapy

An experimental process of inserting genes into germ cells or fertilized eggs to cause a genetic change that can be passed on to offspring. May be used to alleviate effects associated with a genetic disease.

Germ line genetic mutation

See: mutation

Glucose Intolerance

A state of blood sugar control that is between normal and diabetes.

"Glucose" is the type of sugar most commonly used for fuel in the human body. Physicians classify people into one of three groups based on their blood sugar readings:

· Normal -- blood sugar is below 110 mg/dl.

· Glucose-intolerant -- blood sugar is between 110 and 126 mg/dl.

· Diabetic -- blood sugar level of 126 mg/dl or greater.

The blood sugar readings are performed on an empty stomach. Technically, therefore, they are "fasting blood sugar" measurements.

Guanine (G)

A nitrogenous base, one member of the base pair GC (guanine and cytosine) in DNA.

Gyandromorph

Organisms that have both male and female cells and therefore express both male and female characteristics.

H

Haploid

A single set of chromosomes (half the full set of genetic material) present in the egg and sperm cells of animals and in the egg and pollen cells of plants. Human beings have 23 chromosomes in their reproductive cells.

Haplotype

A way of denoting the collective genotype of a number of closely linked loci on a chromosome.

Hemizygous

Having only one copy of a particular gene. For example, in humans, males are hemizygous for genes found on the Y chromosome.

Hereditary Non-Polyposis Colon Cancer (HNPCC)

An inherited form of colorectal cancer.

Related term(s) : familial_adenomatous_polyposis

Heterozygote

See: heterozygosity

Heterozygosity

The presence of different alleles at one or more loci on homologous chromosomes.

Heterozygous

Having two different versions of the same gene, one version on one chromosome and the second version on the other.

For example, an individual is heterozygous for the eye color gene if they have the gene version for blue eye color on one chromosome, and brown on the other.

Related term(s) :· homozygous

HGMP

Human Genome Mapping Project.
The UK HGMP Resource Centre is an academic institution in the UK which provides a number of services, including access to databases, mirrors of databases, and access to extensive services/software for registered academic users.

HLA Complex

A region on the short arm of chromosome 6 that contains many genes involved in the immune system. HLA stands for "human lymphocyte antigen."

The genes in the HLA complex are divided into three groups, or classes:

· class I -- "Transplant." The class I genes are blueprints for proteins that sit on the surface of every cell. These proteins act like fingerprints. They allow the immune system to distinguish "self" from "non-self." When a person receives an organ transplant, his or her immune system attacks the transplanted organ because it has a different HLA class I "fingerprint" and is therefore recognized as foreign. The HLA-A, HLA-B, and HLA-C genes are all HLA class I genes.

· class II -- "Immune communication." The class II genes are the blueprints for proteins involved in communication between cells of the immune system. The HLA-DR, HLA-DQ, and HLA-DP genes are all HLA class II genes.

· class III -- "Complement." The class III genes are blueprints for the "complement" class of immune-system proteins.

Highly conserved sequence

DNA sequence that is very similar across several different types of organisms.
See also: gene, mutation

High-throughput sequencing

A fast method of determining the order of bases in DNA.
See also: sequencing

Homeobox

A short stretch of nucleotides whose base sequence is virtually identical in all the genes that contain it. Homeoboxes have been found in many organisms from fruit flies to human beings. In the fruit fly, a homeobox appears to determine when particular groups of genes are expressed during development.

Homolog

A member of a chromosome pair in diploid organisms or a gene that has the same origin and functions in two or more species.

Homologous chromosome

Chromosome containing the same linear gene sequences as another, each derived from one parent.

Homologous recombination

Swapping of DNA fragments between paired chromosomes.

Homology

Similarity in DNA or protein sequences between individuals of the same species or among different species.

Homozygote

An organism that has two identical alleles of a gene. See also: heterozygote

Homozygous

See: homozygote

Having two identical versions of the same gene, one on each chromosome.

For example, an individual can be homozygous for the eye color gene if they have the gene version for blue eye color on both chromosomes.

Related term(s) · heterozygous

Human artificial chromosome (HAC)

A vector used to hold large DNA fragments.
See also: chromosome, DNA

Human gene therapy

See: gene therapy

Human Genome Initiative

Collective name for several projects begun in 1986 by DOE to create an ordered set of DNA segments from known chromosomal locations, develop new computational methods for analyzing genetic map and DNA sequence data, and develop new techniques and instruments for detecting and analyzing DNA. This DOE initiative is now known as the Human Genome Program. The joint national effort, led by DOE and NIH, is known as the Human Genome Project.

Human Genome Project (HGP)

Formerly titled Human Genome Initiative.
See also: Human Genome Initiative

Human Lymphocyte Antigen

See HLA.

Huntington's Disease

A disorder caused by a defect in a gene for a protein found in brain cells.

The disease appears in middle age and results in dementia and premature death.

Hybrid

The offspring of genetically different parents.
See also: heterozygote

Hybridization

The process of joining two complementary strands of DNA or one each of DNA and RNA to form a double-stranded molecule.

I

Identical Twins

Twins that have identical DNA.

For several reasons, "identical twins" is a poor term, and is not used in professional medical language. We use it frequently on the DNA.com^TM website because it is readily understood by our users.

The main problem is that identical twins are not necessarily identical. We frequently hear that one twin has a mole that the other does not, for example. More dramatically, some identical twins are "mirror images" of each other, even though they have the same DNA. In such cases, which are rare, one twin's heart is on their left side (normal) and one twin's heart is on their right side (mirror image). The most famous example of mirror twins are Tweedledee and Tweedledum from Alice's Adventures in Wonderland.

The medical profession prefers to use the term monozygotic twins. This term describes how the twins arose (from one fertilized egg), rather than the way they look.

Related term(s) : dizygotic_twins

Immune System

The system within the body that attempts to destroy anything that is not a normal part of oneself.

The chief function of the immune system is to fight infections. It has other activities, including: (a) when it recognizes a cancer as "not normal," it will attack the tumor; (b) it will attempt to destroy tissue that is transplanted into the body (with a few exceptions); and (c) it sometimes goes awry and attacks normal bodily tissues.

Some of the key tools used by the immune system are inflammation and complement.

Immunotherapy

Using the immune system to treat disease, for example, in the development of vaccines. May also refer to the therapy of diseases caused by the immune system.
See also: cancer

Imprinting

A phenomenon in which the disease phenotype depends on which parent passed on the disease gene. For instance, both Prader-Willi and Angelman syndromes are inherited when the same part of chromosome 15 is missing. When the father's complement of 15 is missing, the child has Prader-Willi, but when the mother's complement of 15 is missing, the child has Angelman syndrome.

In situ hybridization

Use of a DNA or RNA probe to detect the presence of the complementary DNA sequence in cloned bacterial or cultured eukaryotic cells.

In vitro

Studies performed outside a living organism such as in a laboratory.

In vivo

Studies carried out in living organisms.

Independent assortment

During meiosis each of the two copies of a gene is distributed to the germ cells independently of the distribution of other genes.
See also: linkage

Inflammation

A complex protective response of the body.

Since the time of ancient Rome, physicians have known the four basic signs of inflammation: rednesss, warmth, swelling, and tenderness. The Romans described this as "rubor, calor, tumor, et dolor." In 1858, a fifth sign was added: loss of function.

Inflammation often goes along with vigorous action of the immune system. You have probably noticed that the skin around an infected cut becomes red, warm, swollen, and tender.

It's often possible to discern that inflammation is part of a disease, just by looking at the name. A word that ends in "-itis" means inflammation. Thus, gastritis is inflammation of the stomach. Neuritis is inflammation of a nerve.

Inherit

In genetics, to receive genetic material from parents through biological processes.

Inherited

See: inherit

Insertion

A chromosome abnormality in which a piece of DNA is incorporated into a gene and thereby disrupts the gene's normal function.
See also: chromosome, DNA, gene, mutation

Insertional mutation

See: insertion

Intellectual property rights

Patents, copyrights, and trademarks. See also: patent

Interference

One crossover event inhibits the chances of another crossover event. Also known as positive interference. Negative interference increases the chance of a second crossover.
See also: crossing over

Interphase

The period in the cell cycle when DNA is replicated in the nucleus; followed by mitosis.

Intron

DNA sequence that interrupts the protein-coding sequence of a gene; an intron is transcribed into RNA but is cut out of the message before it is translated into protein.
See also: exon

Non-coding region of DNA.

Ion

An atom that carries an electric charge.

By definition, an atom has no electric charge. Some atoms, however, have a marked tendency to pick up an extra electron. This makes them a negatively charged ion. Other atoms have a tendency to lose an electron. This makes them a positively charged ion.

Isoenzyme

An enzyme performing the same function as another enzyme but having a different set of amino acids. The two enzymes may function at different speeds.

J

Junk DNA

Stretches of DNA that do not code for genes; most of the genome consists of so-called junk DNA which may have regulatory and other functions. Also called non-coding DNA.

K

Karyotype

A photomicrograph of an individual's chromosomes arranged in a standard format showing the number, size, and shape of each chromosome type; used in low-resolution physical mapping to correlate gross chromosomal abnormalities with the characteristics of specific diseases.

Kilobase (kb)

Unit of length for DNA fragments equal to 1000 nucleotides.

Knockout

Deactivation of specific genes; used in laboratory organisms to study gene function.
See also: gene, locus, model organisms

L

Library

An unordered collection of clones (i.e., cloned DNA from a particular organism) whose relationship to each other can be established by physical mapping. See also: genomic library, arrayed library

Linkage

The proximity of two or more markers (e.g., genes, RFLP markers) on a chromosome; the closer the markers, the lower the probability that they will be separated during DNA repair or replication processes (binary fission in prokaryotes, mitosis or meiosis in eukaryotes), and hence the greater the probability that they will be inherited together.

Linkage disequilibrium

Where alleles occur together more often than can be accounted for by chance. Indicates that the two alleles are physically close on the DNA strand.
See also: Mendelian inheritance

Linkage map

A map of the relative positions of genetic loci on a chromosome, determined on the basis of how often the loci are inherited together. Distance is measured in centimorgans (cM).

Localize

Determination of the original position (locus) of a gene or other marker on a chromosome.

Locus (pl. loci)

The specific place on a chromosome that a given gene occupies.

The position on a chromosome of a gene or other chromosome marker; also, the DNA at that position. The use of locus is sometimes restricted to mean expressed DNA regions.
See also: gene expression

Long-Range Restriction Mapping

Restriction enzymes are proteins that cut DNA at precise locations. Restriction maps depict the chromosomal positions of restriction-enzyme cutting sites. These are used as biochemical "signposts," or markers of specific areas along the chromosomes. The map will detail the positions where the DNA molecule is cut by particular restriction enzymes.

M

Macrorestriction map

Map depicting the order of and distance between sites at which restriction enzymes cleave chromosomes.

Major Histocompatibility Complex (MHC)

In laboratory mice, the name for the equivalent of the HLA complex found in humans.

Mapping

See: gene mapping, linkage map, physical map

Mapping population

The group of related organisms used in constructing a genetic map.

Marker

See: genetic marker

Mass spectrometry

An instrument used to identify chemicals in a substance by their mass and charge.

Megabase (Mb)

Unit of length for DNA fragments equal to 1 million nucleotides and roughly equal to 1 cM.
See also: centimorgan

Meiosis

The process of two consecutive cell divisions in the diploid progenitors of sex cells. Meiosis results in four rather than two daughter cells, each with a haploid set of chromosomes.
See also: mitosis

Mendelian inheritance

One method in which genetic traits are passed from parents to offspring. Named for Gregor Mendel, who first studied and recognized the existence of genes and this method of inheritance.
See also: autosomal dominant, recessive gene, sex-linked

Messenger RNA (mRNA)

RNA that serves as a template for protein synthesis.
See also: genetic code

Metaphase

A stage in mitosis or meiosis during which the chromosomes are aligned along the equatorial plane of the cell.

Microarray

Sets of miniaturized chemical reaction areas that may also be used to test DNA fragments, antibodies, or proteins.

Microbial genetics

The study of genes and gene function in bacteria, archaea, and other microorganisms. Often used in research in the fields of bioremediation, alternative energy, and disease prevention.
See also: model organisms, biotechnology, bioremediation

Microinjection

A technique for introducing a solution of DNA into a cell using a fine microcapillary pipet.

Micronuclei

Chromosome fragments that are not incorporated into the nucleus at cell division.

Mitochondrial DNA

The genetic material found in mitochondria, the organelles that generate energy for the cell. Not inherited in the same fashion as nucleic DNA.
See also: cell, DNA, genome, nucleus

Mitosis

The process of nuclear division in cells that produces daughter cells that are genetically identical to each other and to the parent cell.
See also: meiosis

Model organisms

A laboratory animal or other organism useful for research.

Microsatellite DNA

Very short pieces of DNA that are repeated 2 to 5 times.

Related term(s) · str · minisatellite_dna

MMDB

Molecular Modelling Database. A taxonomy assigned database of PDB (see PDB) files, and related information.

Minisatellite DNA

Short pieces of DNA that are repeated 7 to 80 times.

Related term(s) · vntr · microsatellite_dna

Mitochondria

The parts of a cell that extract energy from oxygen.

We all need oxygen to live. Our bodies use oxygen to slowly burn the food we eat. The resulting energy is packaged in chemicals and used to power the many chemical reactions that keep us alive.

Mitochondria are the specialized structures inside a cell that burn sugar and repackage the energy. Mitochondria have their own DNA. A schematic drawing of a cell, with its mitochondria, is shown at right.

"Mitochondria" is pronounced "my-toe-CON-dree-uh." "Mitochondria" is the plural form. The singular form is "mitochondrion

Mitochondrial DNA

DNA found in the mitochondria.

Of the 3 billion base pairs ("DNA letters") in all of human DNA, only 16,569 are in the mitochondrial DNA. The other 99.9995% of human DNA is nuclear DNA found in the chromosomes.

Because all mitochondria come from the mother of an individual, all mitochondrial DNA comes from the mother.

Mitosis

The process of nuclear division in cells that produces daughter cells that are genetically identical to each other and to the parent cell.
See also: meiosis

Model organisms

A laboratory animal or other organism useful for research.

Modeling

The use of statistical analysis, computer analysis, or model organisms to predict outcomes of research.

Molecular biology

The study of the structure, function, and makeup of biologically important molecules.

Molecular farming

The development of transgenic animals to produce human proteins for medical use.

Molecular genetics

The study of macromolecules important in biological inheritance.

Molecular medicine

The treatment of injury or disease at the molecular level. Examples include the use of DNA-based diagnostic tests or medicine derived from DNA sequence information.

Monogenic disorder

A disorder caused by mutation of a single gene.
See also: mutation, polygenic disorder

Monogenic inheritance

See: monogenic disorder

Monosomy

Possessing only one copy of a particular chromosome instead of the normal two copies.
See also: cell, chromosome, gene expression, trisomy

Monozygotic Twins

Twins that arose from a single fertilized egg.

All human beings start as a single cell, the zygote. This cell divides into a clump of two cells, these two cells divide into a clump of four cells, and so on. Ultimately, a human being develops from the growing clump of cells.

If, while the clump is small, it splits into two separate clumps, then a human being can develop from each clump. The result is monozygotic twins, so named becuase they started from the same zygote.

	Fragment	Meaning	Language
derivation	mono	single	Greek
derivation	zygote	fertilized egg	Greek

Not all twins are monozygotic. Most are dizygotic. Among the public, monozygotic twins are called identical twins, even though this is not completely accurate.

It is commonly assumed, even by physicians, that monozygotic twins have the same DNA. This is usually correct, because both twins started with the zygote's DNA. The key word, however, is "started." DNA can become damaged or mutated at any time. If it happens early in development, it can affect most or all of the cells in the body. If it happens late in development, or after birth, the effect is not so widespread.

Monozygotic triplets have been reported. This was quite rare before the advent of fertility treatments.

Morbid map

A diagram showing the chromosomal location of genes associated with disease.

Mouse model

See: model organisms

Multifactorial or multigenic disorder

See: polygenic disorder

Multi-Factorial Disease

A disease that appears because of more than one factor, usually genetic and environmental.

Mutagen

Anything that causes mutations in DNA. An agent that causes a permanent genetic change in a cell. Does not include changes occurring during normal genetic recombination.

X rays and and some chemicals are mutagens.

Mutation

A change in one of the letters of DNA.

Example: Changing a T for an A, or a C for a G. Mutations are generally harmful and therefore are rare.

N

Nature and Nurture

"Nature" refers to genetic influences. "Nurture" refers to environmental influences.

NCBI

National Center for Biotechnology Information (USA). Created by the United States Congress in 1988, to develop information systems to support the biological research community.

Neuron

A cell in the brain or spinal cord that transmits electrical impulses.

There are many types of cells in the brain and spinal cord. Not all are neurons. For example, some cells are support cells, similar to scaffolding.

Because they function like wires, some neurons look like wires. The longest cell in the human body goes from your spine to your big toe. Below, we show a schematic drawing of a neuron, in which electrical impulses always move from left to right.

Neurons may become quite complicated in structure, as the example below shows:

NIH

National Institutes of Health (USA).

Nitrogenous base

A nitrogen-containing molecule having the chemical properties of a base. DNA contains the nitrogenous bases adenine (A), guanine (G), cytosine (C), and thymine (T).
See also: DNA

Northern blot

A gel-based laboratory procedure that locates mRNA sequences on a gel that are complementary to a piece of DNA used as a probe.
See also: DNA, library

Nuclear DNA

DNA in the chromosomes, as opposed to DNA in the mitochondria.

Related term(s) · mitochondrial_dna

Nuclear transfer

A laboratory procedure in which a cell's nucleus is removed and placed into an oocyte with its own nucleus removed so the genetic information from the donor nucleus controls the resulting cell. Such cells can be induced to form embryos. This process was used to create the cloned sheep "Dolly". See also: cloning

Nucleic acid

A large molecule composed of nucleotide subunits.
See also: DNA

Nucleolar organizing region

A part of the chromosome containing rRNA genes.

Nucleotide

A subunit of DNA or RNA consisting of a nitrogenous base (adenine, guanine, thymine, or cytosine in DNA; adenine, guanine, uracil, or cytosine in RNA), a phosphate molecule, and a sugar molecule (deoxyribose in DNA and ribose in RNA). Thousands of nucleotides are linked to form a DNA or RNA molecule.
See also: DNA, base pair, RNA

Nucleotide Base

One of the four basic building blocks of DNA referred to by their letter abbreviations A, C, G, and T.

Each letter is an abbreviation for the name of a chemical. Their full names are adenine, cytosine, guanine, and thymine.

These four chemicals belong to a class of chemicals called "nucleotides." (They also belong to a family of chemicals called "bases." Bases behave oppositely from acids.) If you are familiar with chemical diagrams, the image below shows the four nucleotide bases found in DNA:

For those who have taken college chemistry, the dashed lines represent a "hydrogen bond." These are weak bonds that make it easy for DNA to unzip down the middle. Because there are three hydrogen bonds between C and G, the C-G "rungs of the DNA ladder" are stronger than the A-T rungs.

Related term(s) dna_letter

Nucleus

The part of the cell that contains the chromosomes. Also, the cellular organelle in eukaryotes that contains most of the genetic material.

O

Oligo

See: oligonucleotide

Oligogenic

A phenotypic trait produced by two or more genes working together.
See also: polygenic disorder

Oligonucleotide

A molecule usually composed of 25 or fewer nucleotides; used as a DNA synthesis primer.
See also: nucleotide

Oncogene

A gene, one or more forms of which is associated with cancer. Many oncogenes are involved, directly or indirectly, in controlling the rate of cell growth.

Oncogenes

Genes causantes de tumores relacionados con el cáncer

Oncologist

A physician who specializes in treating cancer patients.

	Fragment	Meaning	Language
derivation	onco	bulk, mass	Greek
derivation	ology	study of	Greek

OMIM

Online Mendelian Inheritance in Man. Database of genetic diseases wuth references to molecular medicine, cell biology, biochemistry and clinical details of the diseases.

Open reading frame (ORF)

The sequence of DNA or RNA located between the start-code sequence (initiation codon) and the stop-code sequence (termination codon).

Operon

A set of genes transcribed under the control of an operator gene.

ORF

Open Reading Frame. A series of codons (base triplets) which can be translated into a protein. There are six potential reading frames of an unidentifed sequence; TBLASTN (see BLAST) transalates a nucleotide sequence in all six reading frames, into a protein, then attempts to align the results to sequeneces in a protein database, returning the results as a nucleotide sequence. The most likely reading frame can be identified using on-line software (e.g. ORF Finder).

Orthologue

Groups of genes or proteins from different organisms that have the same function, are said to be orthologous. There are numerous genes that have been conserved through evolutionary history. The protein products can be identified in yeast, a nematode worm and human cells, for example. It can be interesting to study the gene function in a worm, if you know that it has the same function in humans.

Overlapping clones

See: genomic library

P

P1-derived artificial chromosome (PAC)

One type of vector used to clone DNA fragments (100- to 300-kb insert size; average, 150 kb) in Escherichia coli cells. Based on bacteriophage (a virus) P1 genome.
See also: cloning vector

anina con la citosina.

Patent

In genetics, conferring the right or title to genes, gene variations, or identifiable portions of sequenced genetic material to an individual or organization.
See also: gene

Pedigree

A family tree diagram that shows how a particular genetic trait or disease has been inherited.
See also: inherit

Penetrance

The probability of a gene or genetic trait being expressed. "Complete" penetrance means the gene or genes for a trait are expressed in all the population who have the genes. "Incomplete" penetrance means the genetic trait is expressed in only part of the population. The percent penetrance also may change with the age range of the population.

Peptide

Two or more amino acids joined by a bond called a "peptide bond."
See also: polypeptide

Phage

A virus for which the natural host is a bacterial cell.

Pharmacogenomics

The study of the interaction of an individual's genetic makeup and response to a drug.

Phenocopy

A trait not caused by inheritance of a gene but appears to be identical to a genetic trait.

Phenotype

The physical characteristics of an organism or the presence of a disease that may or may not be genetic.
See also: genotype

Physical map

A map of the locations of identifiable landmarks on DNA (e.g., restriction-enzyme cutting sites, genes), regardless of inheritance. Distance is measured in base pairs. For the human genome, the lowest-resolution physical map is the banding patterns on the 24 different chromosomes; the highest-resolution map is the complete nucleotide sequence of the chromosomes.

Plasmid

Autonomously replicating extra-chromosomal circular DNA molecules, distinct from the normal bacterial genome and nonessential for cell survival under nonselective conditions. Some plasmids are capable of integrating into the host genome. A number of artificially constructed plasmids are used as cloning vectors.

Pleiotropy

One gene that causes many different physical traits such as multiple disease symptoms.

Pluripotency

The potential of a cell to develop into more than one type of mature cell, depending on environment.

Polygenic disorder

Genetic disorder resulting from the combined action of alleles of more than one gene (e.g., heart disease, diabetes, and some cancers). Although such disorders are inherited, they depend on the simultaneous presence of several alleles; thus the hereditary patterns usually are more complex than those of single-gene disorders.
See also: single-gene disorder

Polymerase chain reaction (PCR)

A method for amplifying a DNA base sequence using a heat-stable polymerase and two 20-base primers, one complementary to the (+) strand at one end of the sequence to be amplified and one complementary to the (-) strand at the other end. Because the newly synthesized DNA strands can subsequently serve as additional templates for the same primer sequences, successive rounds of primer annealing, strand elongation, and dissociation produce rapid and highly specific amplification of the desired sequence. PCR also can be used to detect the existence of the defined sequence in a DNA sample.

PCR

See polymerase chain reaction.

PDB

Brookhaven Protein Data Bank. A database and format of files which describe the 3D structure of a protein or nucleic acid, as determined by X-ray crystallography or nuclear magnetic resonance (NMR) imaging. The molecules described by the files are usually viewed locally by dedicated software, but can sometimes be visualised on the world wide web.

Polymerase, DNA or RNA

Enzyme that catalyzes the synthesis of nucleic acids on preexisting nucleic acid templates, assembling RNA from ribonucleotides or DNA from deoxyribonucleotides.

Polymorphism

Difference in DNA sequence among individuals that may underlie differences in health. Genetic variations occurring in more than 1% of a population would be considered useful polymorphisms for genetic linkage analysis.
See also: mutation

Polypeptide

A protein or part of a protein made of a chain of amino acids joined by a peptide bond.

Population genetics

The study of variation in genes among a group of individuals.

Positional cloning

A technique used to identify genes, usually those that are associated with diseases, based on their location on a chromosome.

Premature chromosome condensation (PCC)

A method of studying chromosomes in the interphase stage of the cell cycle.

Primer

Short preexisting polynucleotide chain to which new deoxyribonucleotides can be added by DNA polymerase.

Phenylketonuria (PKU)

A disease caused by a defect in the gene for a specific protein -- the protein that degrades the amino acid phenylalanine.

PKU can result in mental retardation if not properly managed

PKU

See phenylketonuria.

PIR

A database of translated GenBank nucleotide sequences. PIR is a redundant (see Redundancy) protein sequence database. The database is divided into four categories:

1. PIR1 - Classified and annotated.

2. PIR2 - Annotated.

3. PIR3 - Unverified.

4. PIR4 - Unencoded or untranslated.

Platelet

Small cells in the blood that help blood clot properly.

Polymerase Chain Reaction (PCR)

A method for making millions of copies of DNA for analysis.

Polyp

A protruding growth from a mucous membrane.

The interior surface of the large intestine is a mucous membrane. The classic polyp has a stalk and looks like a golfball sitting on a golf tee.

Probe

Single-stranded DNA or RNA molecules of specific base sequence, labeled either radioactively or immunologically, that are used to detect the complementary base sequence by hybridization.

Prognosis

The forecast of the probable outcome of an illness.

Prokaryote

Cell or organism lacking a membrane-bound, structurally discrete nucleus and other subcellular compartments. Bacteria are examples of prokaryotes.
See also: chromosome, eukaryote

Promoter

A DNA site to which RNA polymerase will bind and initiate transcription.

The portion of a gene responsible for determining if the gene is read and decoded.

Pronucleus

The nucleus of a sperm or egg prior to fertilization.
See also: nucleus, transgenic

Prophylactic Mastectomy

Surgical removal of the breast before the appearance of disease.

This operation is most often performed in women who are at very high risk of breast cancer.

Protein

A family of large natural chemicals in the body.

A large molecule composed of one or more chains of amino acids in a specific order; the order is determined by the base sequence of nucleotides in the gene that codes for the protein. Proteins are required for the structure, function, and regulation of the body's cells, tissues, and organs; and each protein has unique functions. Examples are hormones, enzymes, and antibodies.

Genes are blueprints for proteins. Each gene tells how to make one protein (sometimes, just one piece of a protein). We write this as:

gene --> protein

Proteins are important because they are the chemicals that "get things done" in all living organisms on earth. Melanin proteins give color to our hair and eyes. Hemoglobin proteins carry oxygen in our blood. Myosin proteins make our muscles move. We write this as:

gene --> protein --> action

An almost infinite number of proteins are possible. Small differences between proteins can make them perform their action more efficiently or less efficiently. These differences between proteins, written in the genes, cause the differences between individuals -- and even the differences between species of animals.

The close relationship between genes and proteins can sometimes lead to name confusion. For example, in some cases, the name of the gene and the name of the protein are the same: XYZ gene and XYZ protein. In other cases, the name of the gene and the name of the protein are different: ABC gene and PQR protein. There is no simple rule.

Proteome

Proteins expressed by a cell or organ at a particular time and under specific conditions.

Proteomics

The study of the full set of proteins encoded by a genome.

Pseudogene

A sequence of DNA similar to a gene but nonfunctional; probably the remnant of a once-functional gene that accumulated mutations.

Purine

A nitrogen-containing, double-ring, basic compound that occurs in nucleic acids. The purines in DNA and RNA are adenine and guanine.
See also: base pair

Pyrimidine

A nitrogen-containing, single-ring, basic compound that occurs in nucleic acids. The pyrimidines in DNA are cytosine and thymine; in RNA, cytosine and uracil.
See also: base pair

Q

R

Radiation hybrid

A hybrid cell containing small fragments of irradiated human chromosomes. Maps of irradiation sites on chromosomes for the human, rat, mouse, and other genomes provide important markers, allowing the construction of very precise STS maps indispensable to studying multifactorial diseases.
See also: sequence tagged site

Rare-cutter enzyme

See: restriction-enzyme cutting site

Recessive

A characteristic of a gene that causes the information it contains to be silenced by the information contained in another version of the same gene.

For example, light-eyed versions of the eye color gene are recessive to the dark-eyed versions.

When a recessive gene is carried on one of the autosomes, the gene may be called autosomal recessive.

Related term(s) · dominant

Recessive gene

A gene which will be expressed only if there are 2 identical copies or, for a male, if one copy is present on the X chromosome.

Reciprocal translocation

When a pair of chromosomes exchange exactly the same length and area of DNA. Results in a shuffling of genes.

Recombinant clone

Clone containing recombinant DNA molecules.
See also: recombinant DNA technology

Recombinant DNA molecules

A combination of DNA molecules of different origin that are joined using recombinant DNA technologies.

A piece of DNA made from several different sources of DNA, such as human and bacterial DNA.

Recombinant DNA is usually made for the purposes of isolating genes

Recombinant DNA technology

Procedure used to join together DNA segments in a cell-free system (an environment outside a cell or organism). Under appropriate conditions, a recombinant DNA molecule can enter a cell and replicate there, either autonomously or after it has become integrated into a cellular chromosome.

Recombination

The process by which progeny derive a combination of genes different from that of either parent. In higher organisms, this can occur by crossing over.
See also: crossing over, mutation

Regulatory region or sequence

A DNA base sequence that controls gene expression.

Repetitive DNA

Sequences of varying lengths that occur in multiple copies in the genome; it represents much of the human genome.

Redundancy

The presence of more than one identical item represents redundancy. In bioinformatics, the term is used with reference to the sequences in a sequence database. If a database is described as being redundant, more than one identical (redundant) sequence may be found. If the database is said to be non-redundant (nr), the database managers have attempted to reduce the redundancy.
The term is ambiguous with reference to genetics, and as such, the degree of non-redundancy varies according to the database manager's interpretation of the term. One can argue whether or not two alleles of a locus defines the limit of redundancy, or whether the same locus in different, closely related organisms constitutes redundency. Non-redundant databases are, in some ways, superior, but are less complete. These factors should be taken into consideration when selecting a database to search.

Reporter gene

See: marker

Resolution

Degree of molecular detail on a physical map of DNA, ranging from low to high.

Restriction enzyme, endonuclease

A protein that recognizes specific, short nucleotide sequences and cuts DNA at those sites. Bacteria contain over 400 such enzymes that recognize and cut more than 100 different DNA sequences.
See also: restriction enzyme cutting site

Restriction fragment length polymorphism (RFLP)

A variation in sizes of DNA seen after cutting with restriction enzymes.

Restriction enzymes cut DNA at a specific site. For example, the EcoR1 restriction enzyme cuts DNA whenever it sees the letters GAATTC:

DNA before cutting by
EcoR1: AATCTAGGGAATTCACAGCGATGCGAATTCGCAATTA

DNA after cutting by
EcoR1: AATCTAGGG - AATTCACAGCGATGCG - AATTCGCAATTA

In this example, EcoR1 has cut the one strand of 37 DNA letters into 3 smaller strands of DNA having 9, 16, and 12 DNA letters. If another person has slightly different DNA, EcoR1 may cut the DNA into pieces of different lengths. (For example: If the second GAATTC is GAATTT, EcoR1 will cut this other person's DNA in only one place, producing 2 smaller strands of DNA having 9 and 28 DNA letters.)

The words "fragment length polymorphism" mean "DNA pieces of different lengths." RFLPs are a quick way to see if two pieces of DNA are identical, without having to look at the entire DNA sequence. It's possible to see different-sized DNA pieces using the Southern blot method.

Variation between individuals in DNA fragment sizes cut by specific restriction enzymes; polymorphic sequences that result in RFLPs are used as markers on both physical maps and genetic linkage maps. RFLPs usually are caused by mutation at a cutting site.
See also: marker, polymorphism

Restriction-enzyme cutting site

A specific nucleotide sequence of DNA at which a particular restriction enzyme cuts the DNA. Some sites occur frequently in DNA (e.g., every several hundred base pairs); others much less frequently (rare-cutter; e.g., every 10,000 base pairs).

Retroviral infection

The presence of retroviral vectors, such as some viruses, which use their recombinant DNA to insert their genetic material into the chromosomes of the host's cells. The virus is then propogated by the host cell.

Reverse transcriptase

An enzyme used by retroviruses to form a complementary DNA sequence (cDNA) from their RNA. The resulting DNA is then inserted into the chromosome of the host cell.

Ribonucleotide

See: nucleotide

Ribose

The five-carbon sugar that serves as a component of RNA.
See also: ribonucleic acid, deoxyribose

Ribosomal RNA (rRNA)

A class of RNA found in the ribosomes of cells.

Ribosomes

Small cellular components composed of specialized ribosomal RNA and protein; site of protein synthesis.
See also: RNA

RFLP

See restriction fragment length polymorphism.

RNA (Ribonucleic acid)

A chemical found in the nucleus and cytoplasm of cells; it plays an important role in protein synthesis and other chemical activities of the cell. The structure of RNA is similar to that of DNA. There are several classes of RNA molecules, including messenger RNA, transfer RNA, ribosomal RNA, and other small RNAs, each serving a different purpose.

S

Sanger sequencing

A widely used method of determining the order of bases in DNA.
See also: sequencing, shotgun sequencing

Satellite DNA

Regions of DNA where short nucleotide sequences repeat over and over; regions of tandem repeats.

A chromosomal segment that branches off from the rest of the chromosome but is still connected by a thin filament or stalk.

Scaffold

In genomic mapping, a series of contigs that are in the right order but not necessarily connected in one continuous stretch of sequence.

Segregation

The normal biological process whereby the two pieces of a chromosome pair are separated during meiosis and randomly distributed to the germ cells.

Sequence

See: base sequence

Sequence assembly

A process whereby the order of multiple sequenced DNA fragments is determined.

Sequence tagged site (STS)

Short (200 to 500 base pairs) DNA sequence that has a single occurrence in the human genome and whose location and base sequence are known. Detectable by polymerase chain reaction, STSs are useful for localizing and orienting the mapping and sequence data reported from many different laboratories and serve as landmarks on the developing physical map of the human genome. Expressed sequence tags (ESTs) are STSs derived from cDNAs.

Short cDNA sequences of regions that have been physically mapped. STSs provide unique landmarks, or identifiers, throughout the genome. Useful as a framework for further sequencing.

Sequencing

Determination of the order of nucleotides (base sequences) in a DNA or RNA molecule or the order of amino acids in a protein.

Sequencing technology

The instrumentation and procedures used to determine the order of nucleotides in DNA.

Seizure

An abrupt change from the brain's normal electrical activity to a pattern in which many brain cells (neurons) have repeated and synchronized electrical discharges.

When a seizure involves the neurons in the part of the brain that controls body movement, the person with the seizure will show repeated jerking movements. These repetitive movements mirror the repetitive electrical discharges happening in the brain.

Other seizures are more difficult to detect by observation. In some types of seizures, the person will appear to "tune out" for a short time. In many kinds of seizures, the person will not lose consciousness or fall down.

Seizures can be detected by recording the brain's electrical activity. This procedure is called an EEG.

Short Tandem Repeats (STR)

Short repeats of 2 to 5 base pairs -- microsatellite DNA.

The word "tandem" means that the repeating segments are immediately adjacent to each other. The following is an example of a short tandem repeat of 3 base pairs:

TTATTATTATTA

Related term(s) · tandem_repeats · vntr

Sex chromosome

The X or Y chromosome in human beings that determines the sex of an individual. Females have two X chromosomes in diploid cells; males have an X and a Y chromosome. The sex chromosomes comprise the 23rd chromosome pair in a karyotype.
See also: autosome

Sex-linked

Traits or diseases associated with the X or Y chromosome; generally seen in males.
See also: gene, mutation, sex chromosome

Shotgun method

Sequencing method that involves randomly sequenced cloned pieces of the genome, with no foreknowledge of where the piece originally came from. This can be contrasted with "directed" strategies, in which pieces of DNA from known chromosomal locations are sequenced. Because there are advantages to both strategies, researchers use both random (or shotgun) and directed strategies in combination to sequence the human genome.
See also: library, genomic library

Single Nucleotide Polymorphism (SNP)

A common variant in the DNA that can have one of several DNA letters (A, T, C, or G) at a single site.

Each individual has many single nucleotide polymorphisms that together create a unique DNA pattern for that person.

DNA sequence variations that occur when a single nucleotide (A, T, C, or G) in the genome sequence is altered.
See also: mutation, polymorphism, single-gene disorder

Single-gene disorder

Hereditary disorder caused by a mutant allele of a single gene (e.g., Duchenne muscular dystrophy, retinoblastoma, sickle cell disease).
See also: polygenic disorders

Snip

Pronounciation of "SNP."

SNP

See single nucleotide polymorphism.

Somatic cell

Any cell in the body except gametes and their precursors.
See also: gamete

Somatic cell gene therapy

Incorporating new genetic material into cells for therapeutic purposes. The new genetic material cannot be passed to offspring.
See also: gene therapy

Somatic cell genetic mutation

A change in the genetic structure that is neither inherited nor passed to offspring. Also called acquired mutations.
See also: germ line genetic mutation

Somatic Gene Therapy

Introducing a gene into the human body for the purposes of correcting a genetic defect or deficiency. Thi specifically excludes inserting the gene into sperm or egg cells.

Related term(s) · germline_gene_therapy · gene_therapy

Southern Blot

A method for visualizing DNA fragments.

Putting two Southern blots next to each other shows at a glance whether they come from one person or two. The example at right shows the Southern blots for three different people. You can see that person #1 has had their DNA cut into two large pieces that show up on the blot (there are lots of other pieces, but they do not show up). The bigger piece is toward the top of the diagram.

The DNA of persons #2 and #3 have been cut differently, because their DNA is not the same as that of person #1. After cutting DNA, persons #2 and #3 have only a single piece of their DNA show up on the blot. Person #2 has the same big piece as person #1, but lacks the smaller piece. Person #3 has the smaller piece only.

The method was developed by Dr. Ed Southern at Oxford University. It is often used to show restriction fragment length polymorphisms.

Southern blotting

Transfer by absorption of DNA fragments separated in electrophoretic gels to membrane filters for detection of specific base sequences by radio-labeled complementary probes.

Spectral karyotype (SKY)

A graphic of all an organism's chromosomes, each labeled with a different color. Useful for identifying chromosomal abnormalities.
See also: chromosome

Splice site

Location in the DNA sequence where RNA removes the noncoding areas to form a continuous gene transcript for translation into a protein.

Stem cell

Undifferentiated, primitive cells in the bone marrow that have the ability both to multiply and to differentiate into specific blood cells.

STR

See short tandem repeats.

Structural genomics

The effort to determine the 3D structures of large numbers of proteins using both experimental techniques and computer simulation

STS

See Sequence Tagged Site

Substitution

In genetics, a type of mutation due to replacement of one nucleotide in a DNA sequence by another nucleotide or replacement of one amino acid in a protein by another amino acid.
See also: mutation

Suppressor gene

A gene that can suppress the action of another gene.

Susceptibility

The ease with which a person develops an illness.

The more susceptible a person is to a given illness, the easier it is for that person to develop the illness. The opposite of susceptibility is resistance. A person may be susceptible to some illnesses, but resistant to others.

Disease susceptibility has genetic and environmental components. For example, light-skinned people (genetically determined) are more susceptible to sunburn. Smokers (environmentally determined) are more susceptible to bronchitis

SWISS-PROT

A non-redundant (See Redundancy) protein sequence database. Thoroughly annotated and cross referenced. A subdivision is TrEMBL.

Syngeneic

Genetically identical members of the same species.

Synteny

Genes occurring in the same order on chromosomes of different species.
See also: linkage, conserved sequence

T

Tandem repeat sequences

Multiple copies of the same base sequence on a chromosome; used as markers in physical mapping.

Short segments of DNA that are repeated over and over.

Related term(s) · str · vntr · satellite_dna

See also: physical map

Targeted mutagenesis

Deliberate change in the genetic structure directed at a specific site on the chromosome. Used in research to determine the targeted region's function.
See also: mutation, polymorphism

Technology transfer

The process of transferring scientific findings from research laboratories to the commercial sector.

Telomerase

The enzyme that directs the replication of telomeres.

Telomere

The end of a chromosome. This specialized structure is involved in the replication and stability of linear DNA molecules.
See also: DNA replication

Teratogenic

Substances such as chemicals or radiation that cause abnormal development of a embryo.
See also: mutatgen

Thymine (T)

A nitrogenous base, one member of the base pair AT (adenine-thymine).
See also: base pair, nucleotide

Toxicogenomics

The study of how genomes respond to environmental stressors or toxicants. Combines genome-wide mRNA expression profiling with protein expression patterns using bioinformatics to understand the role of gene-environment interactions in disease and dysfunction.

Transcription

The synthesis of an RNA copy from a sequence of DNA (a gene); the first step in gene expression.
See also: translation

Transcription factor

A protein that binds to regulatory regions and helps control gene expression.

Transcriptasa inversa

Enzima retrovírica capaz de transformar ARN en ADN.

Telomere

The end of a chromosome. This specialized structure is involved in the replication and stability of linear DNA molecules.
See also: DNA replication

Teratogenic

Substances such as chemicals or radiation that cause abnormal development of a embryo.
See also: mutatgen

Thymine (T)

A nitrogenous base, one member of the base pair AT (adenine-thymine).
See also: base pair, nucleotide

Toxicogenomics

Transcription

The synthesis of an RNA copy from a sequence of DNA (a gene); the first step in gene expression.
See also: translation

Transcription factor

A protein that binds to regulatory regions and helps control gene expression.

Transposable element

A class of DNA sequences that can move from one chromosomal site to another.

TrEMBL

A protein sequence database of Translated EMBL nucleotide sequences.

Trisomy

Possessing three copies of a particular chromosome instead of the normal two copies.
See also: cell, gene, gene expression, chromosome

Twin Studies

Scientific studies performed on pairs of twins.

These studies can answer many questions in medical genetics. They are especially useful for deciding whether a certain condition is genetic, environmental, or both. To understand how twin studies work, you must know two things:

· There are two types of twins: (a) Identical twins, who have 100% of their genes in common, and (b) non-identical twins, who have 50% of their genes in common (on average).

· If they are raised together, twins share a similar environment.

Here's an example of the information that twin studies can provide. In 1995, researchers in New Jersey studied 84 pairs of twins, in which at least one twin had asthma. For each pair, they recorded the type of twin (identical or non-identical) and whether one or both twins had asthma:

Type of twin pair	Number of twin pairs	Twin pairs in which both twins had asthma ("concordance rate")
Identical twins	39	59% (23 out of 39)
Non-identical twins	55	24% (13 out of 55)

If asthma were governed only by genes, then every time one identical twin had asthma, the other should have it, too. (Because identical twins have the same genes.) In other words, the "concordance rate" should be 100%. The table shows, however, that instead of a 100% concordance, there is only a 59% concordance between identical twins. This is good evidence that asthma is not purely a genetic disease.

If asthma were purely an environmental condition, then genes should make no difference at all. The concordance rate would, therefore, be the same for identical twins as for non-identical twins. The table shows, however, that the concordance rate is more than twice as high in identical twins (59%) as in non-identical twins (24%). This is good evidence that asthma is not purely an environmental disease.

This type of analysis works for almost all conditions, not just asthma.

U

UniGene

Database of unique human genes, at NCBI. Entries are selected by near identical presence in GenBank and dbEST databases. The clusters of sequences produced are considered to represent a single gene.

Upstream

Toward the 5' end of a nucleotide sequence.

Uracil

A nitrogenous base normally found in RNA but not DNA; uracil is capable of forming a base pair with adenine.
See also: base pair, nucleotide

V

Variable Number Tandem Repeats (VNTR)

Minisatellite DNA with repeats of 9 to 80 base pairs.

The word "tandem" means that the repeating segments are immediately adjacent to each other. The following is an example of a short tandem repeat of 9 base pairs:

TAAGGGCCATAAGGGCCATAAGGGCCA

Related term(s) · tandem_repeats · str

Vector

See: cloning vector

Virus

A noncellular biological entity that can reproduce only within a host cell. Viruses consist of nucleic acid covered by protein; some animal viruses are also surrounded by membrane. Inside the infected cell, the virus uses the synthetic capability of the host to produce progeny virus.
See also: cloning vector

VNTR

See variable number tandem repeats.

W

Western blot

A technique used to identify and locate proteins based on their ability to bind to specific antibodies.
See also: DNA, Northern blot, protein, RNA, Southern blotting

Wild Type

The version of a gene that is the most common version in a population. The form of an organism that occurs most frequently in nature.

Working Draft DNA Sequence

See: Draft DNA Sequence

X

Y

Y chromosome

One of the two sex chromosomes, X and Y.
See also: X chromosome, sex chromosome

Yeast artificial chromosome (YAC)

Constructed from yeast DNA, it is a vector used to clone large DNA fragments.
See also: cloning vector, cosmid

Z

Zinc-finger protein

A secondary feature of some proteins containing a zinc atom; a DNA-binding protein

Zygote

Fertilized egg, created when sperm cell and egg fuse.

Alphabetically, the end. Biologically, the beginning.

Related term(s) · gamete